ftp.delorie.com/archives/browse.cgi | search |
X-Authentication-Warning: | delorie.com: mail set sender to djgpp-bounces using -f |
From: | Rich <listme AT listme DOT dsbl DOT org> |
Organization: | MIBnet |
User-Agent: | Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.5) Gecko/20031013 Thunderbird/0.3 |
X-Accept-Language: | en-us, en |
MIME-Version: | 1.0 |
Newsgroups: | comp.os.msdos.djgpp |
Subject: | Re: LFN support for XP? |
References: | <vqlmfln660qqdb AT corp DOT supernews DOT com> <3FACD610 DOT 834713DD AT phekda DOT freeserve DOT co DOT uk> <vqvj4ami9t4362 AT corp DOT supernews DOT com> |
In-Reply-To: | <vqvj4ami9t4362@corp.supernews.com> |
X-Enigmail-Version: | 0.81.7.0 |
X-Enigmail-Supports: | pgp-inline, pgp-mime |
X-Forwarded: | for mibnet.plus.com via NNTP Proxy |
Lines: | 46 |
Message-ID: | <Gw0sb.6883$lm1.48762@wards.force9.net> |
Date: | Tue, 11 Nov 2003 07:49:20 +0000 |
NNTP-Posting-Host: | 212.159.3.244 |
X-Complaints-To: | abuse AT plus DOT net DOT uk |
X-Trace: | wards.force9.net 1068536998 212.159.3.244 (Tue, 11 Nov 2003 07:49:58 GMT) |
NNTP-Posting-Date: | Tue, 11 Nov 2003 07:49:58 GMT |
X-Received-Date: | Tue, 11 Nov 2003 08:48:44 MET (news01.chello.no) |
To: | djgpp AT delorie DOT com |
DJ-Gateway: | from newsgroup comp.os.msdos.djgpp |
Reply-To: | djgpp AT delorie DOT com |
-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Tim Boston randomly hit the keyboard and managed to write on 10/11/2003 17:36: | Hi, | | I'm using the default install of DJGPP 2.03 currently available from | www.delorie.com. | | If I create a file called test.c like so: | int main() { return 0; } | | ....this compiles fine. | | If I rename the file to testtesttest.c and compile it, I get this: | | cc1.exe: testtesttest.c: No such file or directory (ENOENT) | | Changing the LFN setting in DJGPP.ENV doesn't affect anything, nor does | manually setting LFN=y (or LFN=n) as an environment variable prior to | compiling... | | Tim. | You are using cmd.exe and not command.com as the shell? Richard - -- - ------------------------------------------------------------------------ ~ My Reply-To address will blacklist you. Use the one below. - ------------------------------------------------------------------------ CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/sJSADehCPPrjI9gRAsA3AJ9R5ufTJd1e9N1RNfK3ddAc+66kqgCgmCM7 QdtRY1qjr9gBanlLV3EtR2k= =oDKP -----END PGP SIGNATURE-----
webmaster | delorie software privacy |
Copyright © 2019 by DJ Delorie | Updated Jul 2019 |